View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0070_low_8 (Length: 250)
Name: NF0070_low_8
Description: NF0070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0070_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 25 - 236
Target Start/End: Complemental strand, 15501610 - 15501399
Alignment:
Q |
25 |
catcaagtgcacacagcttattgatacaacaattcaatcaaacaacataggaaggtcaaaatgtaaatgacatgaaaataaccaagaaggaaatgaaaat |
124 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
15501610 |
catcaagtgcacacagcttattaatacaacaattcaatcaaacaacataggaaggtcaaaacgtaaatgacatgaaaataaccaagaaggaaatgaaaat |
15501511 |
T |
 |
Q |
125 |
ccatgnnnnnnnnttctcaaagaccatttctggcaaagagaattgcaatcagaataggaacaaatccaccaattactgagtgacaattgaggctgcttgc |
224 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15501510 |
ccatgaaaaaaaattctcaaagaccatttctggcaaagagaattgcaatgagaataggaacaaatccaccaattactgagtgacaattgaggctgcttgc |
15501411 |
T |
 |
Q |
225 |
aaagctagaagg |
236 |
Q |
|
|
|||||||||||| |
|
|
T |
15501410 |
aaagctagaagg |
15501399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 714 times since January 2019
Visitors: 1282