View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0072_high_3 (Length: 256)
Name: NF0072_high_3
Description: NF0072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0072_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 101 - 245
Target Start/End: Complemental strand, 37573586 - 37573435
Alignment:
Q |
101 |
ctgcactgcacaaaacggctacagcagaagaaga---gacataacaaac----cattgtttactgctcactcactccctcgcacagctagctagctgtac |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37573586 |
ctgcactgcacaaaacggctacagcagaagaagaagagacataacaaacaaaccattgtttactgctcactcactccctcgcacagctagctagctgtac |
37573487 |
T |
 |
Q |
194 |
tgtacgtacgtgtgtacaatctctctctaatatctccttaccacgtgtctct |
245 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
37573486 |
tgtacgtacgtgtgtacaatctctctctaatctctccttaccacgtgtctct |
37573435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University