View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0072_low_4 (Length: 262)
Name: NF0072_low_4
Description: NF0072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0072_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 30842256 - 30842078
Alignment:
| Q |
1 |
atgatgaagaaaatacttctagtctcgacaattcttctttgtctgcgttttcaaccaccgttagggctgcttcaacttcttctgttcttggccttgccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842256 |
atgatgaagaaaatacttctagtcccgacgattcttctttgtctgcgttttcaaccaccgttagggctgcttcaacttcttctgttcttggccttgccgg |
30842157 |
T |
|
| Q |
101 |
taatgatctgtgagttttcattatttcttctactgcatcttccgttgatcgtgataatgatggcgacgacggtgatgat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842156 |
taatgatctgtgagttttcattatttcttctactgcatcttctgttgatcgtgataatgatggcgacgacggtgatgat |
30842078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1022 times since January 2019
Visitors: 1289