View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0072_low_5 (Length: 262)
Name: NF0072_low_5
Description: NF0072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0072_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 2 - 186
Target Start/End: Original strand, 30842233 - 30842417
Alignment:
| Q |
2 |
gactagaagtattttcttcatcatcatcgtctagaaaatccaaaggttcttcttccatgtcggaagagcttttaacaattttacaagagatacggaaaag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30842233 |
gactagaagtattttcttcatcatcatcgtctagaaaatccaaaggttcttcttccatgtcggaagagcttttaacaattttacaagagatgcggaaaag |
30842332 |
T |
|
| Q |
102 |
tattgtgtctttcgaatgcaaagagaaaaagagagatgctcttaaactcttagaacacgaaaaagttcatgttctatttgatgat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
30842333 |
tattgtgtctttcgaatgcaaagagaaaaagagagatgctcttaaactcttagaactcgaaaaagttcatgttctgtttgatgat |
30842417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 916 times since January 2019
Visitors: 1288