View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0074_high_2 (Length: 330)
Name: NF0074_high_2
Description: NF0074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0074_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 3 - 286
Target Start/End: Original strand, 1721085 - 1721367
Alignment:
| Q |
3 |
atcactcattatttgatcaggccaagtatatatgcatctaacaagaagaatgtttaaatagagaagttttcaactcaagtgtaccattggatttgagctg |
102 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1721085 |
atcactcattatttgatcagggcaagtatatatgcatctaacaagaagaatgtttaaatagagaagttttcaactcaagtgtaccattggatttgagctg |
1721184 |
T |
 |
| Q |
103 |
tcttcagctcaaatatgaaaacaaacattatttttggattgacaactttcacctttgtcgatgcattttctttcagaaaattgtgaaccgttacataaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1721185 |
tcttcagctcaaatatgaaaacaaacattatttttggattgacaactttcacctttgttaatgcattttctttcagaaaattgtgaaccgttacataaac |
1721284 |
T |
 |
| Q |
203 |
aaagctacatattttttgtattaataaaaaagatgtgaaatgtggaatccaatccctcaaattggaggatgcatattggttacc |
286 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1721285 |
aaagttacatattttttgtattaat-aaaaagatgtgaaatgtggaatccaatccctcaaattggaggatgcatattggttacc |
1721367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University