View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0074_high_3 (Length: 256)

Name: NF0074_high_3
Description: NF0074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0074_high_3
NF0074_high_3
[»] chr1 (2 HSPs)
chr1 (126-192)||(36573542-36573608)
chr1 (210-238)||(36573647-36573675)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 126 - 192
Target Start/End: Original strand, 36573542 - 36573608
Alignment:
126 gtagttaaaatatatcattgtttattgttttaatttaattataatccatgtgggaataaaatatagg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36573542 gtagttaaaatatatcattgtttattgttttaatttaattataatccatgtgggaataaaatatagg 36573608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 36573647 - 36573675
Alignment:
210 attgcaaaattgaaaggggcatactatgt 238  Q
    |||||||||||||||||||||||||||||    
36573647 attgcaaaattgaaaggggcatactatgt 36573675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1307 times since January 2019
Visitors: 1296