View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0074_high_6 (Length: 224)
Name: NF0074_high_6
Description: NF0074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0074_high_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 3950025 - 3950248
Alignment:
| Q |
1 |
tcacaaatacaacataaaactcacacccataactccgaggtcttgggttggaacacaggtaaagaggtccaacctatcaatatcggtattgtcagttaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3950025 |
tcacaaatacaacataaaactcacacccataactccgaggtctcgggttggaacacaggtaaagaggtccaacctatcaatatcggtattgtcagttaag |
3950124 |
T |
|
| Q |
101 |
ctaaactttacaagctcgtggtaagaaaataatagtactaattgagttttgtgttaattttgatgaattttttctcttaaatgatttttattgcaaagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3950125 |
ctaaactttacaagctcgtggtaagaaaataatagtactaattgagttttgtgttaattttgatgaattttttctcttaaatgatttttattgcaaagtt |
3950224 |
T |
|
| Q |
201 |
ctgtgggaattatccccattcatc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3950225 |
ctgtgggaattatccccattcatc |
3950248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 114
Target Start/End: Complemental strand, 44090615 - 44090562
Alignment:
| Q |
61 |
aaagaggtccaacctatcaatatcggtattgtcagttaagctaaactttacaag |
114 |
Q |
| |
|
||||| || ||||||| ||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
44090615 |
aaagatgttcaacctaacaatatcagtattgtcagttgatctaaactttacaag |
44090562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1497 times since January 2019
Visitors: 1302