View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0074_low_6 (Length: 256)
Name: NF0074_low_6
Description: NF0074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0074_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 126 - 192
Target Start/End: Original strand, 36573542 - 36573608
Alignment:
Q |
126 |
gtagttaaaatatatcattgtttattgttttaatttaattataatccatgtgggaataaaatatagg |
192 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36573542 |
gtagttaaaatatatcattgtttattgttttaatttaattataatccatgtgggaataaaatatagg |
36573608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 36573647 - 36573675
Alignment:
Q |
210 |
attgcaaaattgaaaggggcatactatgt |
238 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
36573647 |
attgcaaaattgaaaggggcatactatgt |
36573675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1348 times since January 2019
Visitors: 1298