View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-14 (Length: 229)
Name: NF0075-INSERTION-14
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075-INSERTION-14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 6 - 216
Target Start/End: Original strand, 46652456 - 46652666
Alignment:
| Q |
6 |
caagattgtatttgtattcatagcattatcattgataataacagggagaataaactcatttggagtgacttctttaatgatatttacttggtaagtcatg |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
46652456 |
caagattgtatttgtattcgtagcattatcattgataataacagggagaataaactcatttggagtgactcctttaatgatatttacttggtcagtcatg |
46652555 |
T |
 |
| Q |
106 |
gatataaatggttggatcaagattcaactcataatttggcaccaacta-ttgttggaactagatttggcagctaccagtagggctagtaataaaccggac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46652556 |
gatataaatggttggatcaagattcaactcataattt-gcaccaactacttgttggaactagatttggcagctaccagtagggctagtaataaaccggac |
46652654 |
T |
 |
| Q |
205 |
caatttgaatat |
216 |
Q |
| |
|
||||| |||||| |
|
|
| T |
46652655 |
caattcgaatat |
46652666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 23427771 - 23427715
Alignment:
| Q |
97 |
taagtcatggatataaatggttggatcaagattcaactcataatttggcaccaacta |
153 |
Q |
| |
|
|||||||||||| ||| || |||||| | |||||||| ||||||| ||||||||||| |
|
|
| T |
23427771 |
taagtcatggatttaagtgtttggataaggattcaacgcataattcggcaccaacta |
23427715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 151
Target Start/End: Original strand, 40644943 - 40644993
Alignment:
| Q |
101 |
tcatggatataaatggttggatcaagattcaactcataatttggcaccaac |
151 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
40644943 |
tcatggatatagatggttggatcaagattcaattcaacaattggcaccaac |
40644993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 153
Target Start/End: Complemental strand, 16364428 - 16364376
Alignment:
| Q |
101 |
tcatggatataaatggttggatcaagattcaactcataatttggcaccaacta |
153 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
16364428 |
tcatggatatagggggttggatcaatattcaactcataatttggtgccaacta |
16364376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University