View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-19 (Length: 684)
Name: NF0075-INSERTION-19
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075-INSERTION-19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 4e-80; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 4e-80
Query Start/End: Original strand, 37 - 196
Target Start/End: Original strand, 32496693 - 32496852
Alignment:
| Q |
37 |
aaaatgagtagtagagttacctcttggacgaaaagtttattaggcgttaactgaattccattaagagaaccaaattcatcagacccagaagtacaacggg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32496693 |
aaaatgagtagtagagttacctcttggacgaaaagtttattaggtgttaactgaattccattaagacaaccaaattcatcagacccagaagtacaacggg |
32496792 |
T |
|
| Q |
137 |
taattaaccgattcttaaccaaccccaaccgcttaaatttctgtaaaaacaatatcaagt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496793 |
taattaaccgattcttaaccaaccccaaccgcttaaatttctgtaaaaacaatatcaagt |
32496852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 130; E-Value: 5e-67
Query Start/End: Original strand, 324 - 464
Target Start/End: Original strand, 32496981 - 32497122
Alignment:
| Q |
324 |
tggctctgcagttggagaaagtagtggagttcattgttgttcgtcacgcaacaacgttgttgttacggagagaagtagaagatgatgatg-ttttttgct |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32496981 |
tggctctgcagttggagaaagtagtggagttcattgttgttcgacacgcaacaacgttgttgttacggagagaagtagaagatgatgatgtttttttgct |
32497080 |
T |
|
| Q |
423 |
gcggttttggtttcactctatgtttgtgttttcataaatttc |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32497081 |
gcggttttggtttcactctatgtttgtgttttcataaatttc |
32497122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 596 - 644
Target Start/End: Original strand, 32497261 - 32497309
Alignment:
| Q |
596 |
tacttgtgattgtggtgcatcctggtgggtggtggtagtagtgtagtgg |
644 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32497261 |
tacttgtgattgtggtgcatcctggtgggtggtggtagtagtgtagtgg |
32497309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 32496649 - 32496682
Alignment:
| Q |
7 |
aacatgaatttgaacactaaaataaagtttaaaa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32496649 |
aacatgaatttgaacactaaaataaagtttaaaa |
32496682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 534 - 564
Target Start/End: Original strand, 32497199 - 32497229
Alignment:
| Q |
534 |
gacaaaagtgattgtggataattatttggtc |
564 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32497199 |
gacaaaagtgattgtggataattatttggtc |
32497229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 854 times since January 2019
Visitors: 1285