View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-2 (Length: 264)
Name: NF0075-INSERTION-2
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075-INSERTION-2 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 264
Target Start/End: Complemental strand, 45303576 - 45303322
Alignment:
| Q |
7 |
acaaagaaagagaaaacgcttttatccacttaaatactagtagtactcatcaaaatgaatctgatcaaacccttcaacttttcccaataaggaatggaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303576 |
acaaagaaagagaaaacgcttttatccacttaaatactagtagtactcatcaaaatgaatctgatcaaacccttcaacttttcccaataaggaatggaga |
45303477 |
T |
|
| Q |
107 |
tcatggatgcactgnnnnnnnnnnnnnnnnnnnnaacattatcaaagagacacagatatcagcttcagcaatcaatgcacccaaccagtttattgagttt |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303476 |
tcatggatgcactgatcatcatcatcatcat---aacattatcaaagagacacagatatcagcttcagcaatcaatgcacccaaccagtttattgagttt |
45303380 |
T |
|
| Q |
207 |
cttcccttgaaaaactgattagaaaagactttgcttttttgtttgttaggtgttggat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303379 |
cttcccttgaaaaactgattagaaaagactttgcttttttgtttgttaggtgttggat |
45303322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 63 - 113
Target Start/End: Complemental strand, 45150317 - 45150267
Alignment:
| Q |
63 |
gaatctgatcaaacccttcaacttttcccaataaggaatggagatcatgga |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45150317 |
gaatctgaccaaacccttcaacttttcccaataaggaatggaagtcatgga |
45150267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 805 times since January 2019
Visitors: 1284