View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-29 (Length: 328)
Name: NF0075-INSERTION-29
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075-INSERTION-29 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 182 - 328
Target Start/End: Complemental strand, 31474197 - 31474051
Alignment:
| Q |
182 |
caccgcgactttcaaattccatgcaccctaaaatcctcgcagtccacacgtcttttttgctcatttccttgctgtttcaaattgaacaacccatatcttc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31474197 |
caccgcgactttcaaattccatgcaccctaaaatcctcgcagtccacacgtcttttttgctcatttccttgctgtttcaaattgaacaacccatatcttc |
31474098 |
T |
 |
| Q |
282 |
tatctcttttcatataaatattcttctctcttcccttatccatttca |
328 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31474097 |
tatctcttttcatataaatatccttctctcttcccttatccatttca |
31474051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 31474354 - 31474270
Alignment:
| Q |
25 |
aagttaacacgccagttgctttatatcctcgtctcataacaaaaatgttttgctgtcattaataataaatgagcatgcctttctt |
109 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31474354 |
aagttaacacgacagttgctttatatcctcgtctcataacaaaaatgttttgcggtcattaataataaatgagcatgcctttctt |
31474270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University