View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-3 (Length: 247)
Name: NF0075-INSERTION-3
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0075-INSERTION-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 94 - 232
Target Start/End: Complemental strand, 20975302 - 20975164
Alignment:
Q |
94 |
ctttaagatagcggttgaaggaggatttcttttacacaagtaatcgaaagattctaggattctaattaacaaaagaataagaggataaattgatcatata |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
T |
20975302 |
ctttaagatagcggttgaaggaggatttcttttacacaagtaattgaaagattctaggattctaaataacagaagaataagaggataaattgatcatata |
20975203 |
T |
 |
Q |
194 |
attagagaccgaaggatatttcaattttgtattttgttt |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20975202 |
attagagaccgaaggatatttcaattttgtattttgttt |
20975164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 20975393 - 20975352
Alignment:
Q |
5 |
acacaaaagaaataaaacaatcagatgaatcactgaatcagg |
46 |
Q |
|
|
||||||||||||||||||||||||||||| || ||||||||| |
|
|
T |
20975393 |
acacaaaagaaataaaacaatcagatgaagcattgaatcagg |
20975352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University