View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-30 (Length: 571)
Name: NF0075-INSERTION-30
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075-INSERTION-30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 3e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 353 - 424
Target Start/End: Original strand, 35080839 - 35080911
Alignment:
| Q |
353 |
tttgatttgaatgatgagatctgaatatgaatattcctaa-atatgtgtatttaatcagaatctgtaaattaa |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35080839 |
tttgatttgaatgatgagatctgaatatgaatattcctaatatatgtgtatttaatcagaatctgtaaattaa |
35080911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 495 - 571
Target Start/End: Original strand, 35080983 - 35081059
Alignment:
| Q |
495 |
cttgtttacaggaccgattttcaatttgaaatggattgaagggtagttttttaatgtgtttagcatactgttaaaga |
571 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35080983 |
cttgtttacattaccgattttcaatttgaaatggattgaagggtaattttttaatgtgtttagcatactgttaaaga |
35081059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 819 times since January 2019
Visitors: 1285