View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075-INSERTION-46 (Length: 292)
Name: NF0075-INSERTION-46
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075-INSERTION-46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 3420518 - 3420279
Alignment:
| Q |
8 |
gaagaaccggtacatgcaaaacaagtggtttggaccttatcgtaggaccacgaacccggttcatggaaatccggttccagatgttgtttcttctttcagt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420518 |
gaagaaccggtacatgcaaaacaagtggtttggaccttatcgtaggaccacgaacccggttcatggaaatccggttccagatgttgtttcttctttcagt |
3420419 |
T |
|
| Q |
108 |
ggcgttaaatgcagattagtcgggttcgacaacgccatgtccgagatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagtagtatcctcta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420418 |
ggcgttaaatgcagattagtcgggttcgacaacgccatgtccgagatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagtagtatcctcta |
3420319 |
T |
|
| Q |
208 |
cacacaactgcaacaattaatatttctggcttgngaattc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3420318 |
cacacaactgcaacaattaatatttctggcttgtgaattc |
3420279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 242 - 292
Target Start/End: Complemental strand, 3420611 - 3420561
Alignment:
| Q |
242 |
gaattcggaggagctgaaacgcaccgttttggctttgtgtggtgctgtgaa |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420611 |
gaattcggaggagctgaaacgcaccgttttggctttgtgtggtgctgtgaa |
3420561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1010 times since January 2019
Visitors: 1289