View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075_low_14 (Length: 300)
Name: NF0075_low_14
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0075_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 31 - 273
Target Start/End: Original strand, 27130103 - 27130345
Alignment:
Q |
31 |
cacagaggcttcaccaggttgaaaatttagaacatgggatgggcaaactcttgagtctgagcaggcgaaaaccagaaactgcaagttgggaaatgcaaaa |
130 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27130103 |
cacaaaggcttcaccaggttgaaaatttagaacataagatgggcaaactcttgagtctgagcaggcgaaaaccagaaactgcaagttgggaaatgcaaaa |
27130202 |
T |
 |
Q |
131 |
taatataacaattatcagtggttggtttttaaccaaagcatcattagaggctaatcaatcccaactaagttgtcccgtaatcgtaggcctgtagctccga |
230 |
Q |
|
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| | |
|
|
T |
27130203 |
ttatataacaattatcagtgattggtttttaaccaaagcatcattagaggctaatcaatcccaactaagttgtcccgtaatcctaggcttgtagctcgaa |
27130302 |
T |
 |
Q |
231 |
tnnnnnnnnnnctgcagaaatatttgatatcgtaggctcaaac |
273 |
Q |
|
|
| |||||||||||||||||||||||||||||||| |
|
|
T |
27130303 |
taaaaaaaaaactgcagaaatatttgatatcgtaggctcaaac |
27130345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University