View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075_low_16 (Length: 268)
Name: NF0075_low_16
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 13 - 121
Target Start/End: Original strand, 30481312 - 30481420
Alignment:
| Q |
13 |
tatgaaaagcagtcaaaagaaataaagatggaggcagaaacaccaacatctctgttttttgattcctgttgaaatcagtagcagaaacatcacctgccaa |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30481312 |
tatgaaacacagtcaaaagaaataaagatggaggcagaaacaccaacatctctgttttttgattcctgttgaaatcagtagcagaaacatcacctgccaa |
30481411 |
T |
 |
| Q |
113 |
agagtgagc |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
30481412 |
agagtgagc |
30481420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 20301583 - 20301522
Alignment:
| Q |
1 |
tgttatacaccgtatgaaaagcagtcaaaagaaataaagatggaggcagaaacaccaacatc |
62 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20301583 |
tgttatacactgtatgaaacacagtcaaaagaaataaagatggaggcagaaacaccaacatc |
20301522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University