View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075_low_18 (Length: 250)
Name: NF0075_low_18
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075_low_18 |
 | |
|
| [»] scaffold0568 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 303764 - 303602
Alignment:
| Q |
1 |
tcatattcctagctagcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303764 |
tcatattcctagctagcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaa |
303665 |
T |
|
| Q |
101 |
ctatcttgagagtcctcttcagatttaatggttaaggaaaagtcttgttccctttgatgatgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
303664 |
ctatcttgagagtcctcttcagatttaatggttaaggaaaagttttgttccctttgatgatgt |
303602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 17059557 - 17059513
Alignment:
| Q |
196 |
atgaacaagatctgaaaccttaaataaattggggaaattgggaca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17059557 |
atgaacaagatctgaaaccttaaataaattggggaaactgggaca |
17059513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: scaffold0568
Description:
Target: scaffold0568; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 1471 - 1435
Alignment:
| Q |
196 |
atgaacaagatctgaaaccttaaataaattggggaaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1471 |
atgaacaagatctgaaaccttaaataaattggggaaa |
1435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 8073 - 8037
Alignment:
| Q |
196 |
atgaacaagatctgaaaccttaaataaattggggaaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8073 |
atgaacaagatctgaaaccttaaataaattggggaaa |
8037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1623 times since January 2019
Visitors: 1303