View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075_low_19 (Length: 249)
Name: NF0075_low_19
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0075_low_19 |
 |  |
|
[»] scaffold0568 (2 HSPs) |
 |  |  |
|
[»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 36 - 155
Target Start/End: Original strand, 303789 - 303908
Alignment:
Q |
36 |
gttaatttgcagaaaaactagagaaacgtgtgaggaagtgtcagaaagaccaacagatgatgggcatgaatggagaaagtatggtcaaaaaacaatcctt |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
303789 |
gttaatttgcagaaaaactagagaaacgtgtgaggaagtgtcagaaagaccaacagatgatgggcatgaatggagaaagtatggtcaaaaaacaatcctt |
303888 |
T |
 |
Q |
136 |
aattccaaatactcaaggtg |
155 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
303889 |
aattccaaatactcaaggtg |
303908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 195 - 239
Target Start/End: Complemental strand, 17059557 - 17059513
Alignment:
Q |
195 |
atgaacaagatctgaaaccttaaataaattggggaaattgggaca |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
17059557 |
atgaacaagatctgaaaccttaaataaattggggaaactgggaca |
17059513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: scaffold0568
Description:
Target: scaffold0568; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 1471 - 1435
Alignment:
Q |
195 |
atgaacaagatctgaaaccttaaataaattggggaaa |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
1471 |
atgaacaagatctgaaaccttaaataaattggggaaa |
1435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 8073 - 8037
Alignment:
Q |
195 |
atgaacaagatctgaaaccttaaataaattggggaaa |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
8073 |
atgaacaagatctgaaaccttaaataaattggggaaa |
8037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 119
Target Start/End: Original strand, 478702 - 478778
Alignment:
Q |
43 |
tgcagaaaaactagagaaacgtgtgaggaagtgtcagaaagaccaacagatgatgggcatgaatggagaaagtatgg |
119 |
Q |
|
|
||||||| ||||| | |||| || ||| | ||| |||||| |||||||||||||||||| |||||||| ||||||| |
|
|
T |
478702 |
tgcagaagaactacacaaacatgggagaaggtgacagaaactccaacagatgatgggcatcaatggagacagtatgg |
478778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University