View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075_low_7 (Length: 386)
Name: NF0075_low_7
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075_low_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 38 - 386
Target Start/End: Complemental strand, 33990414 - 33990066
Alignment:
| Q |
38 |
gcagaacctgtgatgcagcaggtgctctacaatcataaaacacagtaaacaacagttaggagggtgcagataccaaaattggttcaaccacagttctcaa |
137 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33990414 |
gcagaaccggtgatgcagcaggtgctctacaatcataaaacatagtaaacaacagttaggagggtgcagataccaaaattggttcaaccacagttctcaa |
33990315 |
T |
|
| Q |
138 |
aaatgtcaactgtttttatataatctgcaagatgaaatatttgcacacnnnnnnngatcatagatagagctaggaaaatgtgaagtatatataatacctt |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33990314 |
aaatgtcaactgtttttgtataatctgcaagatgaaatatttgcacacaaaaaaagatcatagatagagctaggaaaatgtgaagtatatataatacctt |
33990215 |
T |
|
| Q |
238 |
ttgcatgtttggtaggagcaatagctggggatgagtatgtaagaattgcattcaactgcgccatattagtttttgctgtatattttcagtcactcactca |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33990214 |
ttgcatgtttggtaggagcaatagctggggatgagtatgtaagaattgcattcaactgcgccatattagtttttgctgtatattttcagtcactcactca |
33990115 |
T |
|
| Q |
338 |
ccacctttttattatggttgtttggaccctcttgagatgctactgtttc |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33990114 |
ccacctttttattatggttgtttggaccctcttgagatgctactgtttc |
33990066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1224 times since January 2019
Visitors: 1293