View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0075_low_9 (Length: 350)
Name: NF0075_low_9
Description: NF0075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0075_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 80 - 253
Target Start/End: Original strand, 48060783 - 48060956
Alignment:
| Q |
80 |
gccctagctgttgcaattttccgtttagctcacggcgctagttacaattccgttgcccggagattcggaatttctccctccgatgcttgccgtgcttttt |
179 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48060783 |
gccctagcagctgcaattttccgtttagctcacggcgctagttacaattccgttgcccggagattcggtatttctccctccgatgcttgccgtgcttttt |
48060882 |
T |
|
| Q |
180 |
tcactgtttgtaaagcggttaatgataatttaggaaatttgtttgagcttcgaactgattctgatagggttgtg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48060883 |
tcactgtttgtaaagcggttaatgataatttaggaaatttgtttgagcttcgaactgattctgatagggttgtg |
48060956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1187 times since January 2019
Visitors: 1293