View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0076-INSERTION-11 (Length: 124)
Name: NF0076-INSERTION-11
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0076-INSERTION-11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 42227821 - 42227951
Alignment:
| Q |
1 |
atcacagtcgcaaatgcaacgaaaattatgtttcttacaatgttatc----taacttcaatggcc---cccaaaccaccaatacactttatcagtctctt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
42227821 |
atcacagtcgcaaatgcaacgaaaattatgtttcttacaatgttatcactctaacttcaatgtcctcccccaaaccaccaatacactttatgagtctctt |
42227920 |
T |
|
| Q |
94 |
tttcttgcaagacttgaagttcaataacata |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42227921 |
tttcttgcaagacttgaagttcaataacata |
42227951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 665 times since January 2019
Visitors: 1282