View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0076-INSERTION-12 (Length: 188)

Name: NF0076-INSERTION-12
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0076-INSERTION-12
NF0076-INSERTION-12
[»] chr3 (2 HSPs)
chr3 (1-144)||(41274906-41275049)
chr3 (141-188)||(41274856-41274903)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 41274906 - 41275049
Alignment:
1 gtttctagttcagctgctcggactccaccaggattgaatgcaaagttttcaactcaccatccggtattgaagagaccgttaacggtagcatttaaaggag 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41274906 gtttctagttcagctgctcggactccactaggattgaatgcaaagttttcaactcaccatccggtattgaagagaccgttaacggtagcatttaaaggag 41275005  T
101 ataaacaaaatgacacagcgttggttgcgactcaagagaaaatt 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
41275006 ataaacaaaatgacacagcgttggttgcgactcaagagaaaatt 41275049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 141 - 188
Target Start/End: Original strand, 41274856 - 41274903
Alignment:
141 aatttctttctaaacactgattctgcaaacttggtatgggagttgtga 188  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||    
41274856 aatttctttctaaacactgattcggcaaacttggtatgggagttgtga 41274903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University