View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0076-INSERTION-12 (Length: 188)
Name: NF0076-INSERTION-12
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0076-INSERTION-12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 41274906 - 41275049
Alignment:
Q |
1 |
gtttctagttcagctgctcggactccaccaggattgaatgcaaagttttcaactcaccatccggtattgaagagaccgttaacggtagcatttaaaggag |
100 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41274906 |
gtttctagttcagctgctcggactccactaggattgaatgcaaagttttcaactcaccatccggtattgaagagaccgttaacggtagcatttaaaggag |
41275005 |
T |
 |
Q |
101 |
ataaacaaaatgacacagcgttggttgcgactcaagagaaaatt |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41275006 |
ataaacaaaatgacacagcgttggttgcgactcaagagaaaatt |
41275049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 141 - 188
Target Start/End: Original strand, 41274856 - 41274903
Alignment:
Q |
141 |
aatttctttctaaacactgattctgcaaacttggtatgggagttgtga |
188 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
41274856 |
aatttctttctaaacactgattcggcaaacttggtatgggagttgtga |
41274903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University