View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0076-INSERTION-13 (Length: 109)
Name: NF0076-INSERTION-13
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0076-INSERTION-13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 30387178 - 30387070
Alignment:
| Q |
1 |
acaagttggcaaaagggaacataacaccgtggctgcagtaggaaacagagtaaaattaacatataagtaggtaataacaccaacgtggcaaaaaattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30387178 |
acaagttggcaaaagggaacataacaccgtggctgtagtaggaaacagagtaaaattaacatataagtaggtaataacactaacgtggcaaaaaattgtt |
30387079 |
T |
 |
| Q |
101 |
ggtccacga |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
30387078 |
ggtccacga |
30387070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University