View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0076-INSERTION-6 (Length: 200)
Name: NF0076-INSERTION-6
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0076-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 36672364 - 36672176
Alignment:
Q |
1 |
catacttcctccgtttcaaaagagatatcatttttactaaattaactctatcaactactgctgtgtgtgtctaagcataaatgtaaagtagaagatgatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36672364 |
catacttcctccgtttcaaaagagatatcatttttactaaattaactctatcaactactgctgtgtgtgtctaagcataaatgtaaagtagaagatgatg |
36672265 |
T |
 |
Q |
101 |
cttcagaagtagtgttctaatagtaataactagatggcataatctatccatgtgaggatttgaactctacaactaagtatcaagataga |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
36672264 |
cttcagaagtagtgttctaatagtaataactagatggcataatctatccatgtgaggatttgaactctataactaagtatcaagataga |
36672176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 52293542 - 52293475
Alignment:
Q |
30 |
atttttactaaattaactctatcaactactgctgtgtgtgtcta---agcataaatgtaaagtagaagat |
96 |
Q |
|
|
||||||||||||||||| |||||||||| || |||||| |||| | ||||||||||||||||||||| |
|
|
T |
52293542 |
atttttactaaattaaccctatcaactattg--gtgtgtatctaaacatcataaatgtaaagtagaagat |
52293475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 650 times since January 2019
Visitors: 1282