View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0076-INSERTION-8 (Length: 165)
Name: NF0076-INSERTION-8
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0076-INSERTION-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 5e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 4 - 165
Target Start/End: Original strand, 37091892 - 37092053
Alignment:
| Q |
4 |
aattcttaatctcttttacgagcttagatctaaaacaaaaggcagattctatgaccaaagaacaagaaaatataatttgttagttaaacttctcttaata |
103 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091892 |
aattcttaatctcttctacgaacttagatctaaaacaaaaggcagattctatgaccaaagaacaagaaaatataatttgttagttaaacttctcttaata |
37091991 |
T |
|
| Q |
104 |
aaacttgtttattatctgcatccgtttgagttaactccccttctgaatattcatccacatat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091992 |
aaacttgtttattatctgcatccgtttgagttaactccccttctgaatattcatccacatat |
37092053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 700 times since January 2019
Visitors: 1282