View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0076_high_3 (Length: 250)
Name: NF0076_high_3
Description: NF0076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0076_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 43984526 - 43984285
Alignment:
Q |
1 |
tcgtatagaattctaagttggttggaagtttctgatcattgggaaaactcaattgagttcatttggtaaaactctgttgcatatattgtagcagtactat |
100 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
43984526 |
tcgtatagaattctaagttggttgcaagtttctgatcattgggaaaactcaattgagttcatttggtaaaactctgttgcatatattgtaacagtactat |
43984427 |
T |
 |
Q |
101 |
catgcatgtgtatacttgtgtgctaatcaagtgtttggagctaattagcatgactcacaagtattgtaagttaagccatacttcatagtttattatagct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43984426 |
catgcatgtgtatacttgtgtgctaatcaagtgtttggagctaattagcatgactcacaagtattgtaagttaagccatacttcatagtttattatagct |
43984327 |
T |
 |
Q |
201 |
ctcggtgcnnnnnnnnttactaattttggtcattcctttgct |
242 |
Q |
|
|
|||||||| |||||||||||||||||| ||||||| |
|
|
T |
43984326 |
ctcggtgcaaaaaaaattactaattttggtcatttctttgct |
43984285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1178 times since January 2019
Visitors: 1293