View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0079_low_3 (Length: 425)
Name: NF0079_low_3
Description: NF0079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0079_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 72 - 417
Target Start/End: Original strand, 52858250 - 52858604
Alignment:
| Q |
72 |
tgatgcataatcaacaacattttcggatattcgagaaagacattcttgtcctcccccggtaaaactcaattcagacttcaatcttgaattgcccctcgtg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52858250 |
tgatgcataatcaacaacattttcggatattcgagaaagacattcttgtcctcccccggtaaaactcaattcagacttcaatcttgaattgcccctcgtg |
52858349 |
T |
|
| Q |
172 |
attgtgaaccctcctccagctgcaattcaatcaaaaatactactactatatatgagatctatcaatataatataatccattgactttgactttgtcttaa |
271 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52858350 |
attgtgaaccctcctccagcttcaattcaatcaaaaa---tactactatatatgagatctatcaatataatataatccattgactttgactttgtcttaa |
52858446 |
T |
|
| Q |
272 |
taaaaacaaacatatacc------------gttattgttattgttattgtggttgagagtggctagatggttgagaaagccggctggagagcttttctga |
359 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52858447 |
taaaaacaaacatataccgttattgttattgttattgttattgttattgtggttgagagtggctagatggttgagaaagccggctggagagcttttctga |
52858546 |
T |
|
| Q |
360 |
cggagcaaagcggatccatcaaagccaccaccttgaccttcgtaagaagatctctgct |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52858547 |
cggagcaaagcggatccatcaaagccaccaccttgaccttcgtaagaagatctctgct |
52858604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 748 times since January 2019
Visitors: 1284