View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0079_low_7 (Length: 212)
Name: NF0079_low_7
Description: NF0079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0079_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 8003017 - 8003178
Alignment:
Q |
1 |
attactccacacataatatagccctttaatctaacactttggaaacttcattctttggctacaccttgcttccgtatttcctaaatctctaactatttgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
8003017 |
attactccacacataatatagccctttagtctaacagtt-ggaaacttcattctttggc---------cttccgtatttcctaaatctctaactatttgc |
8003106 |
T |
 |
Q |
101 |
ctctacctcgttctgtgacgttgactcaccctcctttgatgagtcattgttttgttgtctcagttcaatgat |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8003107 |
ctctacctcgttctgtgacgttgactcaccctcctttgatgagtcattgttttgttgtctcagttcaatgat |
8003178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University