View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0080_high_3 (Length: 403)
Name: NF0080_high_3
Description: NF0080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0080_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 6 - 296
Target Start/End: Original strand, 10490594 - 10490891
Alignment:
Q |
6 |
agcagcagagttgaaatatggtggaatgttgactctttgcccataatatgcctgaagatataacagaaacttaaaatcaccaaaagtagtttttaatgga |
105 |
Q |
|
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
T |
10490594 |
agcagccgagttgaaatatggaggaatgttgactctttgcccataatatgcctgaagatatagcagaaactttaaatcaccaaaagtagtttttaatggg |
10490693 |
T |
 |
Q |
106 |
caattcttttcaaaagtgaaagcaatctgggaccaatgtaaatcccatcatagatatcatagtccgttcctcgcagattatcaaatcc-------agttg |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
10490694 |
caattcttttcaaaagtgaaagcaatctgggaccaatgtaaatcccatcatagatatcatagtccgttcctcgcagattatcaaatccagttgcaagttg |
10490793 |
T |
 |
Q |
199 |
cgacactatgctgaatttgagagccaatcaaaatgggggnnnnnnnntacatgggcaatatatttcaaataagatagctgaagttttcatgaaaatat |
296 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10490794 |
cgacactatgctgaatttgagagccaatcaaaatgggggaaaaaaaatacatgggcaatatatttcaaataagatagctgaagttttcatgaaaatat |
10490891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University