View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0080_high_6 (Length: 257)
Name: NF0080_high_6
Description: NF0080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0080_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 29 - 257
Target Start/End: Original strand, 590449 - 590677
Alignment:
| Q |
29 |
atagattgcatctagtgtttctaatttattgcctcctgattcaacagatggattctccataaaataggtcataatcaaaccaagaagtaatggcatctgc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
590449 |
atagattgcatctagtgtttctaatttattgcctcctgattcaacagatggattctccataaaataggtcataatcaaaccaagaagtaatggcatctgc |
590548 |
T |
 |
| Q |
129 |
agctagagcccgttgtgctgttaaccattgtttcacacaagatttcatgatgccccctacttcttcaaaacaattggagcctgattttacaacttgtgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
590549 |
agctagagcccgttgtgctgttaaccattgtttcacacaagatttcatgatgccccctacttcttcaaaacaattggagcctgattttacaactagtgat |
590648 |
T |
 |
| Q |
229 |
tccactgattctgacatgaaatggtggct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
590649 |
tccactgattctgacatgaaatggtggct |
590677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University