View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0080_low_12 (Length: 202)
Name: NF0080_low_12
Description: NF0080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0080_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 9e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 30 - 122
Target Start/End: Complemental strand, 45105779 - 45105690
Alignment:
| Q |
30 |
tagatatctttgtttattatgagaagaagaagaagaatgggggagctatattttattaaatagaagaaaataaagaactcaaagtttaggcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45105779 |
tagatatctttgtttattatgagaagaagaagaa---tgggggagctatattttattaaatagaagaaaataaagaactcaaagtttacgcaa |
45105690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1313 times since January 2019
Visitors: 1296