View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0080_low_3 (Length: 422)
Name: NF0080_low_3
Description: NF0080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0080_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 49583954 - 49584296
Alignment:
| Q |
1 |
aggcaacgtgagcttttgtttcgtctgatgccgaatgtaccggaggaagttcaaaatgaattacttgaggtaatgacataaacaatttcaaagtttttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49583954 |
aggcaacgtgagcttttgtttcgtctgataccgaatgtaccggaggaagttcaaaatgaattacttgaggtaatgacataaacaatttcaaagtttttca |
49584053 |
T |
|
| Q |
101 |
ttttaatatcgattgttactccgtccactgtcatggattggatctatacttattgatttgtcttccatacttattatttgttatgttcaattgattggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
49584054 |
ttttaatatcgattgttactccgtccattgtcatggattggatctatacttattgatttgtcttccatactta----ttgctatgttcaattgattggta |
49584149 |
T |
|
| Q |
201 |
ggtgtcagagacacttgcagaaaggaacattagtccagaagattatttttcgactctgaaaaatttaattgggctcaaagcccttgttgatggattagca |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584150 |
ggtgtcagagacacttgcagagaggaacattagtccagaagattatttttcgactctgaaaaatttaattgggctcaaagcccttgttgatggattagca |
49584249 |
T |
|
| Q |
301 |
atcggtaaaggnnnnnnngatcttatatgcccccatgttgatgatgt |
347 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49584250 |
atcggtaaaggaaaaaaagatcttatatgcccccatgttgatgatgt |
49584296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 836 times since January 2019
Visitors: 1285