View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0080_low_4 (Length: 418)
Name: NF0080_low_4
Description: NF0080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0080_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 49290742 - 49290940
Alignment:
| Q |
1 |
acacacaatgataaagaaacaaatcaataataaatagggacttacaattattttactggttttggttttgtcacggagtgggcgtacaaataccacagca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290742 |
acacacaatgataaagaaacaaat-------aaatagggacttacaattattttactggttttggttttgtcacggagtgggcgtacaaataccacagca |
49290834 |
T |
 |
| Q |
101 |
aaaggatcagattttccaattatatctttatttgttaagttctttgcctgcactagttttacatctagtgttccaacgggtttcaattctaggttactgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290835 |
aaaggatcagattttccaattatatctttatttgataagttctttgcctgcactagttttacatctagtgttccaacgggtttcaattctaggttactgt |
49290934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 298 - 399
Target Start/End: Original strand, 49291022 - 49291123
Alignment:
| Q |
298 |
atttataattccaaaataaaatgcaatacgatcaatacatgccaacaaccaagatagcaatcaactctctcagaaaattgaagattcatcaacatgaatt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49291022 |
atttataattccaaaataaaatgcaatacgatcaatacatgccaacaaccaagatagcaatcaactctctcagaaaattgaagattcatcaacatgaatt |
49291121 |
T |
 |
| Q |
398 |
tg |
399 |
Q |
| |
|
|| |
|
|
| T |
49291122 |
tg |
49291123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University