View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0080_low_9 (Length: 374)
Name: NF0080_low_9
Description: NF0080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0080_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 24 - 354
Target Start/End: Original strand, 28988029 - 28988356
Alignment:
Q |
24 |
tcataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtatccaaaacgcaccggtgtctgacactgacac |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
28988029 |
tcataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtgtccaaaacgcaccggtgtctgacactgacac |
28988128 |
T |
 |
Q |
124 |
aacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtctaagttagaattttggagctt |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
28988129 |
aacacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtataagttagaattttggagctt |
28988228 |
T |
 |
Q |
224 |
taaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtacattgattatgttaatgatgcttccgggttctgatt |
323 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
T |
28988229 |
taaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtac---gattatgttaatgatgcttctgggttctgatt |
28988325 |
T |
 |
Q |
324 |
ttgagccctgttattttgtggctgatgatgt |
354 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
28988326 |
ttgagccctgttattttgtggctgatgatgt |
28988356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 146 - 175
Target Start/End: Original strand, 44572654 - 44572683
Alignment:
Q |
146 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
175 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
44572654 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
44572683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University