View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0081_low_1 (Length: 382)
Name: NF0081_low_1
Description: NF0081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0081_low_1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 92 - 382
Target Start/End: Complemental strand, 18867161 - 18866871
Alignment:
| Q |
92 |
ggcaacatacattttagcaaacaaatctttggtgatgagcttcgttccgaaactatcagctgcaaaagttatcaaatttagaatttcccttatggtgtcc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18867161 |
ggcaacatacattttagcaaacaaatctttggtgatgagcttcattccgaaactatcagctgcaaaagttatcaaatttagaatttcccttatggtgtcc |
18867062 |
T |
|
| Q |
192 |
caaagttcccagctttgaatatactttagctttctttccatatcaggcaactcaagctttccattgcgtaagcattttgaaatctttggaaccaaagata |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18867061 |
caaagttcccagctttgaatatactttagctttctttccatatcaggcaactcaagctttccattgcgtaagcattttgaaatctttggaaccaaagata |
18866962 |
T |
|
| Q |
292 |
catcaaacgcgtaaaacttgaatataatgagaagatacattatatcttgtatagcaagtttacattttttctcttctaattctgcaatcct |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18866961 |
catcaaacgcgtaaaacttgaatataatgagaagatacattatatcttgtatagcaagtttacattttttctcttctaattctgcaatcct |
18866871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1095 times since January 2019
Visitors: 1291