View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0082_high_2 (Length: 252)
Name: NF0082_high_2
Description: NF0082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0082_high_2 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 6685830 - 6686052
Alignment:
| Q |
30 |
ttaaggtgtctttattgtaactgtctatagacggcaatgccaacttcttcaacaagctaaaggaatcttcataacttaatcccttcaaatgaaatagaga |
129 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6685830 |
ttaaggtgtctttctcgtaactgtctatagacggcaatgccaacttcttcaacaagctaaaggaatcttcataacttaatcccttcaaatgaaatagaga |
6685929 |
T |
 |
| Q |
130 |
gttgactccaatttcctcggccacaattctacaacgagttgtcaatagaaatcttagtttcgcaagccaccccacacatcaaagaacttgtgagttgatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6685930 |
gttgactccaatttcctcggccacaattctacaacgagttgtcaatagaaatcttagtttcgcaagccaccccacacatcaaagaacttgtgagttgatt |
6686029 |
T |
 |
| Q |
230 |
ccatttttcacaagtcaagtttc |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6686030 |
ccatttttcacaagtcaagtttc |
6686052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University