View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0083_low_1 (Length: 278)
Name: NF0083_low_1
Description: NF0083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0083_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 103 - 245
Target Start/End: Original strand, 10102969 - 10103111
Alignment:
Q |
103 |
ttaacgtctcataatgtattttagggtaatgaagttgtactttatcatccagcagaagaatttttaccaactatccaagaggtaatattattcattaatt |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
10102969 |
ttaacgtctcataatgtattttagggtaatgaagttgtactttatcatccagcagaagaatttttaccaacaatccaagaggtaatattattcattaatt |
10103068 |
T |
 |
Q |
203 |
tgttcttaaaatgaacaaacttctttatgtaccctttgcttct |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
10103069 |
tgttcttaaaatgaacaaacttctttatgtaccctttggttct |
10103111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 57 - 99
Target Start/End: Original strand, 10102621 - 10102663
Alignment:
Q |
57 |
atcagaacaatcttgtttgagacatacataacaataaggataa |
99 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
10102621 |
atcataacaatcttgtttgagacatacataacaataagaataa |
10102663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University