View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084-Insertion-13 (Length: 78)
Name: NF0084-Insertion-13
Description: NF0084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084-Insertion-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 30261972 - 30261902
Alignment:
| Q |
8 |
agaatttctctctggtttggagcaacattgctctagtctaggagttcttggaactctggtatcattttctg |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30261972 |
agaatttctctctggtttggagcaacattgctctggtctaggagttcttagaactctggtatcattttctg |
30261902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 922 times since January 2019
Visitors: 1288