View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_1D_low_10 (Length: 236)
Name: NF0084_1D_low_10
Description: NF0084_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_1D_low_10 |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 162
Target Start/End: Complemental strand, 183761 - 183618
Alignment:
| Q |
19 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
183761 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
183662 |
T |
 |
| Q |
119 |
gagtaatgcaaacattggtgagaatccaatgccccgaaaaccta |
162 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
183661 |
gagtaacgcaaacattggtgagaatccaatgccccgaaaaccta |
183618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 183482 - 183548
Alignment:
| Q |
157 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgatgtccatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
183482 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgttgtccatc |
183548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 162
Target Start/End: Original strand, 493755 - 493898
Alignment:
| Q |
19 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493755 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
493854 |
T |
 |
| Q |
119 |
gagtaatgcaaacattggtgagaatccaatgccccgaaaaccta |
162 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493855 |
gagtaacgcaaacattggtgagaatccaatgccccgaaaaccta |
493898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 162
Target Start/End: Original strand, 18191416 - 18191559
Alignment:
| Q |
19 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18191416 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
18191515 |
T |
 |
| Q |
119 |
gagtaatgcaaacattggtgagaatccaatgccccgaaaaccta |
162 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18191516 |
gagtaacgcaaacattggtgagaatccaatgccccgaaaaccta |
18191559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 494034 - 493968
Alignment:
| Q |
157 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgatgtccatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
494034 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgttgtccatc |
493968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 18191695 - 18191629
Alignment:
| Q |
157 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgatgtccatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18191695 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgttgtccatc |
18191629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 162
Target Start/End: Original strand, 34658754 - 34658897
Alignment:
| Q |
19 |
ctgtgggatctaaaaatgaatcggtaggggagcgttccgccttagaacgaagtacccgcgcgagcagggttggacgaagcggaagcgagaatgtcggctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34658754 |
ctgtgggatctaaaaatgaatcggtaggggagagttccgccttagaacgaagtacccgcgcgagcaggtttggacgaagcggaagcgagaatgtcggctt |
34658853 |
T |
 |
| Q |
119 |
gagtaatgcaaacattggtgagaatccaatgccccgaaaaccta |
162 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34658854 |
gagtaacgcaaacattggtgagaatccaatgccccgaaaaccta |
34658897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 34659033 - 34658967
Alignment:
| Q |
157 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgatgtccatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34659033 |
aacctagcctcctccgtccctcgggaccaacaagaggtagtacaggaatattcacctgttgtccatc |
34658967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 45610202 - 45610235
Alignment:
| Q |
181 |
gaccaacaagaggtagtacaggaatattcacctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45610202 |
gaccaacaagaggtagtacaggaatattcacctg |
45610235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 188
Target Start/End: Complemental strand, 14404563 - 14404532
Alignment:
| Q |
157 |
aacctagcctcctccgtccctcgggaccaaca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14404563 |
aacctagcctcctccgtccctcgggaccaaca |
14404532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University