View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_high_21 (Length: 280)
Name: NF0084_2D_high_21
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0084_2D_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 32024757 - 32024990
Alignment:
Q |
1 |
ttctaattttcacttcaaaatgctatgtaatcgtgtggtggcggtgaaaagaagacaaaccaaacatacacttagtttgttcgttgacctttgataatct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
32024757 |
ttctaattttcacttcaaaatgctatgtaatcgtgtggtggcggtgaaaagaagacaaaccaaacatacacttagtttgtt----gacctttgataatct |
32024852 |
T |
 |
Q |
101 |
ttaataatgaggaaaatagatatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32024853 |
ttaataatgaggaaaatagatatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgtt |
32024952 |
T |
 |
Q |
201 |
ttctatttaatttgttgatttgggtttatgtttgatgt |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
32024953 |
ttctatttaatttgttgatttgggtttatgtttgatgt |
32024990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 120 - 205
Target Start/End: Original strand, 32026304 - 32026389
Alignment:
Q |
120 |
atatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttcta |
205 |
Q |
|
|
|||||||| |||||||||| || || ||| ||| |||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
T |
32026304 |
atatgtgaatctcttttggatttaagtgtatgagtaaatgaaattttgatgatctgtgtgtttgacttcattttggttgttttcta |
32026389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University