View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_high_23 (Length: 233)
Name: NF0084_2D_high_23
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0084_2D_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 29 - 219
Target Start/End: Complemental strand, 49070552 - 49070362
Alignment:
Q |
29 |
ccttatgaggagcttcatagtatattgttcttcttctcatgggaggcgagttcaatgtctcaacagaaaatttaaccagcatttcacgcccaccaacatc |
128 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49070552 |
ccttatgaggaccttcatagtatattgttcttcttctcataggaggcgagttcaatgtctcaacagaaaatttaaccagcatttcacgcccaccaacatc |
49070453 |
T |
 |
Q |
129 |
cttcaattgaaacggaaaacaaagtttcattattaagataaaaacaaatagatatgatagtgactaaccgatccatccaatgcaacaagtg |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
T |
49070452 |
cttcaattgaaacggaaaacaaagtttcattattaagataaaaacaaatagatatgatagtgactaaccgatccatccaacgcagcaagtg |
49070362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 49074981 - 49075020
Alignment:
Q |
5 |
gaggtactatgatcatccaagtatccttatgaggagcttc |
44 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49074981 |
gaggtactatgatcatccaagtatccttatgaggagcttc |
49075020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1282 times since January 2019
Visitors: 1296