View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_16 (Length: 810)
Name: NF0084_2D_low_16
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_2D_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 259 - 601
Target Start/End: Original strand, 7525565 - 7525918
Alignment:
| Q |
259 |
ccatttgtgtttg-gttttccttgtgaattggaatagggtttttattgtgtgatttgtgaattattattattcactttgtgacaagttgaaattgtgatg |
357 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
7525565 |
ccatttgtgtgtgagttttccttatgaattggaatagggtttttattgtgtgatttgtgaattattatt---cactttgtgacaagtagaaattgtgatg |
7525661 |
T |
 |
| Q |
358 |
atgg-------------ggagggggaactgaatttgaccgataaatcaggaaaagggggacatgctctgtgtggttattgggtagagatattatttttag |
444 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525662 |
atggatgatgaagatggggagagggaactgaatttgaccgataaatcaggaaaagggggacatgctctgtgtggttattgggtagagatattatttttag |
7525761 |
T |
 |
| Q |
445 |
gtatttagttactctccaataattgaagaacatatgggtgttgttatgggttattaaattccaaaaattggacaaggaaaagtagatagccaataattga |
544 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
7525762 |
gtatttagttactctccaataattgatggacatatgggtgttgttatgggttattaaattccaaaaattggattagaaaaagtagatagccaataattga |
7525861 |
T |
 |
| Q |
545 |
tggacatatgggtgatgtggatttgccatctccataatcagaccaataccatactac |
601 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525862 |
aggacatatgggtgatgtggatttgccatctccataatcagaccaataccatactac |
7525918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 20 - 92
Target Start/End: Original strand, 7525326 - 7525398
Alignment:
| Q |
20 |
ggatgtgtatgtgtataggatggttgctgggttaggggatggtgggagggagttgagaatggaagagaaatgg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525326 |
ggatgtgtatgtgtataggatggttgctgggttaggggatggtgggagggagttgagaatggaagagaaatgg |
7525398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 136 - 194
Target Start/End: Original strand, 7525442 - 7525500
Alignment:
| Q |
136 |
ccacgtggatgatgtaggtttgaggagagttattagattgttgttcttgttcgtgttgt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525442 |
ccacgtggatgatgtaggtttgaggagagttattagattgttgttcttgttcgtgttgt |
7525500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 708 - 776
Target Start/End: Original strand, 7526004 - 7526073
Alignment:
| Q |
708 |
gttggtcctttataataaaa-aatgtagatatgttctttaatttgtttaaatggtatcatattagtcttt |
776 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7526004 |
gttggtcttttataataaaaaaatgtagatatgttctttaatttgtttaaatggtattatattagtcttt |
7526073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 739 - 776
Target Start/End: Original strand, 24517968 - 24518005
Alignment:
| Q |
739 |
gttctttaatttgtttaaatggtatcatattagtcttt |
776 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
24517968 |
gttctttcatttgtttaattggtatcatattagtcttt |
24518005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 724 - 772
Target Start/End: Complemental strand, 51691448 - 51691400
Alignment:
| Q |
724 |
aaaaaatgtagatatgttctttaatttgtttaaatggtatcatattagt |
772 |
Q |
| |
|
||||| || |||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
51691448 |
aaaaagtgcagatatgtcctttaatttgtttaattggtatcatattagt |
51691400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University