View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_33 (Length: 359)
Name: NF0084_2D_low_33
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_2D_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 22 - 310
Target Start/End: Complemental strand, 17737569 - 17737282
Alignment:
| Q |
22 |
catactattaaacttgaaaattgacccccaaaaaatgtgactagagggtcatattctagcgtctattttttattatttt--tagattctaacgtctaata |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
17737569 |
catactattaaacttgaaaattaacccccaaaaaatgtgactagagg-tcatattctagcgtctattttttttttttttattagattctaacgtctaata |
17737471 |
T |
|
| Q |
120 |
tcttcattcttaaccatgaaccaagaaagtaaatgaggtatatttgtccgtggctataagatgaatacgacctaacgtgcttgattcaaaatacgaacca |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17737470 |
tcttcattcttaaccatgaaccaaga--gtaaatgaggtatatttgtccgtagctataagatgaatacgacctaacgtgcttgattcaaaatactaacca |
17737373 |
T |
|
| Q |
220 |
attattatttatacacagttagggacttaggcttattgatttagatggatggaaaaacatgttggccagctattatatcaataatggcaga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17737372 |
attattatttatacacagttagggacttaggcttgatgatttagatggatggaaaaacatgttggccagctattatatcaataatggcaga |
17737282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 311 - 339
Target Start/End: Complemental strand, 17737233 - 17737205
Alignment:
| Q |
311 |
tgtgagggacgtgtaacatgctaaaacag |
339 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17737233 |
tgtgagggacgtgtaacatgctaaaacag |
17737205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1067 times since January 2019
Visitors: 1289