View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_35 (Length: 337)
Name: NF0084_2D_low_35
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0084_2D_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 79 - 322
Target Start/End: Complemental strand, 40757604 - 40757361
Alignment:
Q |
79 |
tatagagtatagatgtttgaaaattttaaattatataacaaactcaacaaacccatatgtattcaacatcataatcatattcatactctattgagttact |
178 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40757604 |
tatagaatatagatgtttgaaaattttaaattatataacaaactcaacaaacccatatgtattcaacatcataatcatattcatactctattgagttact |
40757505 |
T |
 |
Q |
179 |
tcaaattcacaccaactcattatcagtcttgttgtaaacacaaagggatctattttagaggtgtttgtttcacctaggaaaaataccaccggcttatatt |
278 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40757504 |
tcaaattcacaccaactcattatcagtcttgttgtaaacacaaagggatctattttagaggtgtttgtttcacctaggaaaaataccaccggcttatatt |
40757405 |
T |
 |
Q |
279 |
atgtcacaagatctaggttctctcatttcaccttatatgatgtc |
322 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
T |
40757404 |
atgtcacaagatccaggttctctcatttcaccttatattatgtc |
40757361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University