View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_36 (Length: 334)
Name: NF0084_2D_low_36
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_2D_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 25 - 316
Target Start/End: Complemental strand, 21645422 - 21645131
Alignment:
| Q |
25 |
tatctttagcactaatatgtgcacctggttccatatggttagttgaaaaacttgcttggtttggaaaatttggataaagactaacataccctcttaaata |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21645422 |
tatctttagcactaatatgtgcacctggttccatatggttagttgaaaaacttgcttggtttggaaaatttggataaagactaacataccctcttaaata |
21645323 |
T |
 |
| Q |
125 |
catcatatcaatgagaaactttttccatgaagcttgccaaccatttgttcttgatttcggaatttgaaccgggtttttcttaggatcttcagtgaacctc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21645322 |
catcatatcaatgagaaactttttccatgaagcttgccaaccatttgttcttgatttcggaatttgaaccggatttttcttaggatcttcagtgaacctc |
21645223 |
T |
 |
| Q |
225 |
atgttcatgtaaacataaaactctctccaatgtttagggaaaaacactgctccccaactacaaggtaattgatgaaggtaaggtgtgtttgg |
316 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21645222 |
atgttcatgtaaacataaaattctctccaatgtttagggaaaaacactgctccccaactacaaggtaattgatgaaggtaaggtgtgtttgg |
21645131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University