View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_47 (Length: 280)
Name: NF0084_2D_low_47
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_2D_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 32024781 - 32024572
Alignment:
| Q |
1 |
tagcattttgaagtgaaaattagaagctaccaagtggagcttccgcgttaatgtgggtttttgtacaccacgaagccaaaccaaacaagcactaagtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024781 |
tagcattttgaagtgaaaattagaagctaccaagtggagcgtccgcgttaatgtgggtttttgtacaccacgaagccaaaccaaacaagcactaagtatt |
32024682 |
T |
 |
| Q |
101 |
atatgcattgtaaaggatcattcttacacaacagcaaataagcttagctacctaaggcacaaatcattaactagacagtaaaagaactacttctacataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024681 |
atatgcattgtaaaggatcattcttacacaacagcaaataagcttagctacctaaggcacaaatcattaactagacagtaaaagaactacttctacataa |
32024582 |
T |
 |
| Q |
201 |
caaccatatc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
32024581 |
caaccatatc |
32024572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University