View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_49 (Length: 262)
Name: NF0084_2D_low_49
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0084_2D_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 114 - 249
Target Start/End: Complemental strand, 39399021 - 39398886
Alignment:
Q |
114 |
gttagttgaattttacactttattcttggcccacctttctactttctaaaaacagaaacaagcttaagaacgggatcccttgcatctccattgttgttgg |
213 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39399021 |
gttagttgaattttacactttattcttggcccaccttactactttctaaaaacagaaagaagcttaagaacgggatcccttgcatctccattgttgttgg |
39398922 |
T |
 |
Q |
214 |
aaagttgataacgtcttttatcttcgtgatgtccat |
249 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| |
|
|
T |
39398921 |
aaagttgataacgtcttttatcttcgtgatttccat |
39398886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 39399140 - 39399112
Alignment:
Q |
1 |
cctcgtaatattaatatatataatgttag |
29 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
39399140 |
cctcgtaatattaatatatataatgttag |
39399112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University