View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_50 (Length: 260)
Name: NF0084_2D_low_50
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0084_2D_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 45127276 - 45127025
Alignment:
Q |
1 |
attcattccttgctatctgtctctacctatcactatccctatccctgatgcagcaacagttcaaccactcacaccaaatccatcttcatcttcaaaagga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
T |
45127276 |
attcattccttgctatctgtctctacctatccctatccctatccctgatgcagcaacagttcaaccactcacaccaaatccatcttcatctttacaagga |
45127177 |
T |
 |
Q |
101 |
acaatccctgcctttcctgaacaagctgatgttgcaagatgccctttaagtctctcagatgaacacttgaatggaataaaaaacgcatgcagttccaaat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
45127176 |
acaatccctgcctttcctgaacaagctgatgttgcaagatgccctttaagtctctcagatgaacacttgaatggaatcaaaaacgcatgcagttccaaat |
45127077 |
T |
 |
Q |
201 |
ccaacaaacatgatgctgctgatgatgaacttcaccgtagccgatgatgtcc |
252 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
45127076 |
ccaacaaacatgatgctgctgatgatgaacttcaccgtagccgatgttgtcc |
45127025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University