View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0084_2D_low_52 (Length: 255)

Name: NF0084_2D_low_52
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0084_2D_low_52
NF0084_2D_low_52
[»] chr7 (1 HSPs)
chr7 (1-235)||(7894823-7895055)
[»] chr2 (1 HSPs)
chr2 (162-199)||(10250736-10250773)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 7894823 - 7895055
Alignment:
1 ctgtcattttggttgttcttgttgttgcaatatcaatgttattgttatctgtgtagcacatacacttttgattgatttcgagtctaatgtatgacatgtg 100  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||    
7894823 ctgtcattttggttgttcttgttgctgcaatatcaatgttattgttatctgtgtagcacatacacttttgattgaaggtgagtctaatgtatgacatgtg 7894922  T
101 tccaccactgatatgacaattacacatgattacatannnnnnnnnnnnnngtagtagatagatgtgattacattgaattgtgttactttttcaaattatc 200  Q
    ||| |||| ||||||||||| || | ||||||||||              ||||| ||||||||||||||||||||||||||||||||||||||||||||    
7894923 tcccccaccgatatgacaatgactcgtgattacata-tttttttatttttgtagt-gatagatgtgattacattgaattgtgttactttttcaaattatc 7895020  T
201 ggtgtcgacgcgtcaatgtccatgtcgtgtatggt 235  Q
    ||||||||||||||||||||||||| |||||||||    
7895021 ggtgtcgacgcgtcaatgtccatgttgtgtatggt 7895055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 162 - 199
Target Start/End: Complemental strand, 10250773 - 10250736
Alignment:
162 atgtgattacattgaattgtgttactttttcaaattat 199  Q
    |||||||||||||||||||||||| ||| |||||||||    
10250773 atgtgattacattgaattgtgttattttctcaaattat 10250736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University