View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_2D_low_52 (Length: 255)
Name: NF0084_2D_low_52
Description: NF0084_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_2D_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 7894823 - 7895055
Alignment:
| Q |
1 |
ctgtcattttggttgttcttgttgttgcaatatcaatgttattgttatctgtgtagcacatacacttttgattgatttcgagtctaatgtatgacatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7894823 |
ctgtcattttggttgttcttgttgctgcaatatcaatgttattgttatctgtgtagcacatacacttttgattgaaggtgagtctaatgtatgacatgtg |
7894922 |
T |
|
| Q |
101 |
tccaccactgatatgacaattacacatgattacatannnnnnnnnnnnnngtagtagatagatgtgattacattgaattgtgttactttttcaaattatc |
200 |
Q |
| |
|
||| |||| ||||||||||| || | |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7894923 |
tcccccaccgatatgacaatgactcgtgattacata-tttttttatttttgtagt-gatagatgtgattacattgaattgtgttactttttcaaattatc |
7895020 |
T |
|
| Q |
201 |
ggtgtcgacgcgtcaatgtccatgtcgtgtatggt |
235 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7895021 |
ggtgtcgacgcgtcaatgtccatgttgtgtatggt |
7895055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 162 - 199
Target Start/End: Complemental strand, 10250773 - 10250736
Alignment:
| Q |
162 |
atgtgattacattgaattgtgttactttttcaaattat |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
10250773 |
atgtgattacattgaattgtgttattttctcaaattat |
10250736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1562 times since January 2019
Visitors: 1302